Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #102842)


Item Catalog # Description Quantity Price (USD)
Plasmid 102842 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Promoter h7SK

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACTGGATCCGGTACCAAGG
  • 3′ sequencing primer TTACGGTTCCTGGCCTTTTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    STAGR_gRNAScaffold_h7SK was a gift from Stefan Stricker (Addgene plasmid # 102842 ; ; RRID:Addgene_102842)
  • For your References section:

    One step generation of customizable gRNA vectors for multiplex CRISPR approaches through string assembly gRNA cloning (STAgR). Breunig CT, Durovic T, Neuner AM, Baumann V, Wiesbeck MF, Koferle A, Gotz M, Ninkovic J, Stricker SH. PLoS One. 2018 Apr 27;13(4):e0196015. doi: 10.1371/journal.pone.0196015. eCollection 2018. 10.1371/journal.pone.0196015 PubMed 29702666