-
PurposeA single-chain light-controllable dSpCas9 with pdDronpa1.2 domains
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102855 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepPB
-
Backbone manufacturerSystem Biosciences
- Total vector size (bp) 15460
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedSpCas9, pdDronpa1.2
-
SpeciesSynthetic; S. pyogenes
-
Insert Size (bp)7639
- Promoter PGK
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- VP64-p64-Rta transcription activator (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGGAGGCCCGGCATTCTG
- 3′ sequencing primer CGCGTATACTAGATTAACCCTAGAAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VPR-ps-dSpCas9 was a gift from Michael Lin (Addgene plasmid # 102855 ; http://n2t.net/addgene:102855 ; RRID:Addgene_102855) -
For your References section:
A Single-Chain Photoswitchable CRISPR-Cas9 Architecture for Light-Inducible Gene Editing and Transcription. Zhou XX, Zou X, Chung HK, Gao Y, Liu Y, Qi LS, Lin MZ. ACS Chem Biol. 2017 Sep 29. doi: 10.1021/acschembio.7b00603. 10.1021/acschembio.7b00603 PubMed 28938067