pLEX307-mFzd5
(Plasmid
#102867)
-
PurposeExpresses mouse Fzd5 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 102867 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLEX_307
-
Backbone manufacturerAddgene #41392 (provided by David Root)
- Backbone size w/o insert (bp) 10065
- Total vector size (bp) 10485
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFrizzled 5
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1757
-
MutationA to G substitution at nucleotide 699 of Fzd5 ORF; the substitution is silent and does not alter the amino acid sequence
-
Entrez GeneFzd5 (a.k.a. 5330434N09Rik, AI427138, Fz-5, Fz5, mFz5)
- Promoter EF1A
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer EF1A promoter forward (TCAAGCCTCAGACAGTGGTTC) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byInsert was PCR amplified from Addgene plasmid #42267 (provided by Jeremy Nathans and Chris Garcia) and subcloned into a modified pENTR-2B vector using FseI and AscI sites.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLEX307-mFzd5 was a gift from Henry Ho (Addgene plasmid # 102867 ; http://n2t.net/addgene:102867 ; RRID:Addgene_102867) -
For your References section:
Kinesin superfamily protein Kif26b links Wnt5a-Ror signaling to the control of cell and tissue behaviors in vertebrates. Susman MW, Karuna EP, Kunz RC, Gujral TS, Cantu AV, Choi SS, Jong BY, Okada K, Scales MK, Hum J, Hu LS, Kirschner MW, Nishinakamura R, Yamada S, Laird DJ, Jao LE, Gygi SP, Greenberg ME, Ho HH. Elife. 2017 Sep 8;6. pii: e26509. doi: 10.7554/eLife.26509. 10.7554/eLife.26509 PubMed 28885975