Skip to main content

pCMV-5U-Venus-PSD-95-3U
(Plasmid #102949)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 102949 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 4141
  • Total vector size (bp) 8304
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PSD-95
  • Alt name
    DLG4, SAP-90
  • Species
    M. musculus (mouse)
  • GenBank ID
    NC_000077.5
  • Entrez Gene
    Dlg4 (a.k.a. Dlgh4, PSD-95, PSD95, SAP90, SAP90A)
  • Promoter CMV
  • Tag / Fusion Protein
    • Venus Fluorescent protein (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site kpnI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GGAACAACACTCAACCCTATCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-5U-Venus-PSD-95-3U was a gift from Gary Bassell (Addgene plasmid # 102949 ; http://n2t.net/addgene:102949 ; RRID:Addgene_102949)
  • For your References section:

    Single-Molecule Imaging of PSD-95 mRNA Translation in Dendrites and Its Dysregulation in a Mouse Model of Fragile X Syndrome. Ifrim MF, Williams KR, Bassell GJ. J Neurosci. 2015 May 6;35(18):7116-30. doi: 10.1523/JNEUROSCI.2802-14.2015. 10.1523/JNEUROSCI.2802-14.2015 PubMed 25948262

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out these options:

Learn More