This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

phage UBC NLS-HA-2XMCP-tagRFPt
(Plasmid #64541)


Item Catalog # Description Quantity Price (USD)
Plasmid 64541 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Total vector size (bp) 7787
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
    2x MS2 coat protein
  • Promoter human ubiquitin C promoter
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • HA (N terminal on insert)
    • tagRFP-T (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer hUBCpro-F2 CGCCGATGATTATATAAGGA
  • 3′ sequencing primer mTagBFP-R
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    phage UBC NLS-HA-2XMCP-tagRFPt was a gift from Jeffrey Chao (Addgene plasmid # 64541)
  • For your References section:

    Translation. An RNA biosensor for imaging the first round of translation from single cells to living animals. Halstead JM, Lionnet T, Wilbertz JH, Wippich F, Ephrussi A, Singer RH, Chao JA. Science. 2015 Mar 20;347(6228):1367-671. doi: 10.1126/science.aaa3380. 10.1126/science.aaa3380 PubMed 25792328