This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pmax pona 12xTRICK 24xMS2SL
(Plasmid #64542)


Item Catalog # Description Quantity Price (USD)
Plasmid 64542 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Total vector size (bp) 7175
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    12x PP7 stem-loops
  • Species
  • Promoter ponA
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • HA (N terminal on insert)
    • dNP799 (N terminal on insert)
    • 24xMS2 stem loops (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer pCasper-hs GCAACTACTGAAATCTGCCAAG
  • 3′ sequencing primer EBV-rev
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Translatable PP7 stem-loops were generated by gene synthesis (Genscript) removing potential stop codons in all three reading frames. The 405 nucleotide stem-loop cassette contained six copies of the PP7 stem-loops and were optimally positioned 40 nucleotides apart to prevent ribosomes stalling at adjacent stem-loops. The PP7 stem-loops were also codon optimized (tRNA abundance and coding potential) and RNA-folding (mfold). The 6x PP7stem-loop cassette was multimerized using SalI and XhoI to generate a cassette with 12 copies of the PP7 stem-loops.

The PP7 stem-loop cassette cloned into a modified version of the pmaxGFP plasmid (Lonza), which contains the CMV immediate early promoter for expression and the β-globin-IgG chimeric intron in the 5′ UTR. The GFP sequence was replaced by NLS-3xHA tagged dNP799 (a fluoregen activating protein). The PP7 stem-loop cassette was fused in-frame to the C-terminus of dNP799. The 24x MS2 stem-loop cassette was cloned downstream of the stop codon of the pp7 stem-loop cassette.

The CMV promoter was replaced by 45 copies of the E/GRE recognition elements (ponA-45) to induce expression of the reporter mRNA in the presence of ponasterone A. The E/GRE elements are bound by a heterodimer of retinoid-X-receptor (RXR) and a synthetic ecodysone receptor (VgEcR).

The final construct contains the following features: ponA-45 - chimeric intron – NLS - 3xHA – dNP799 – 12x PP7 stem-loops – stop codon – 24x MS2 stem-loops – SV40 polyA. See publication for more details.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmax pona 12xTRICK 24xMS2SL was a gift from Jeffrey Chao (Addgene plasmid # 64542)
  • For your References section:

    Translation. An RNA biosensor for imaging the first round of translation from single cells to living animals. Halstead JM, Lionnet T, Wilbertz JH, Wippich F, Ephrussi A, Singer RH, Chao JA. Science. 2015 Mar 20;347(6228):1367-671. doi: 10.1126/science.aaa3380. 10.1126/science.aaa3380 PubMed 25792328