pHCD1B
(Plasmid
#102953)
-
Purposemammalian expression of CD1B
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102953 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneBCMGSNeo
-
Backbone manufacturerKarasuyama, Kudo & Melchers, 1990
- Backbone size w/o insert (bp) 13940
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD1B cDNA
-
Alt nameNM_001764
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1021
-
Entrez GeneCD1B (a.k.a. CD1, CD1A, R1)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGTTGTTGTGCTGTCTCATC
- 3′ sequencing primer TGCACCTGAGGAGTGAATTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHCD1B was a gift from Gennaro De Libero & Lucia Mori (Addgene plasmid # 102953 ; http://n2t.net/addgene:102953 ; RRID:Addgene_102953) -
For your References section:
CD1a and CD1b surface expression is independent from de novo synthesized glycosphingolipids. Manolova V, Hirabayashi Y, Mori L, De Libero G. Eur J Immunol. 2003 Jan;33(1):29-37. 10.1002/immu.200390004 PubMed 12594829