pCAGGS_HA-VP35_EBOV
(Plasmid
#103053)
-
PurposeMammalian expression vector encoding HA-tagged Ebola virus VP35 gene under control of the CAG promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 103053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGGs
- Total vector size (bp) 5831
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVP35
-
Alt nameVP35 gene of Ebola virus
-
SpeciesZaire ebolavirus, Mayinga
-
Entrez GeneVP35 (a.k.a. ZEBOVgp2)
- Promoter CAG
-
Tag
/ Fusion Protein
- HA-tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn 1 (unknown if destroyed)
- 3′ cloning site Not 1 (unknown if destroyed)
- 5′ sequencing primer CAG-F GCAACGTGCTGGTTATTGTG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGGS_HA-VP35_EBOV was a gift from Elke Mühlberger (Addgene plasmid # 103053 ; http://n2t.net/addgene:103053 ; RRID:Addgene_103053) -
For your References section:
Ebola Virus Does Not Induce Stress Granule Formation during Infection and Sequesters Stress Granule Proteins within Viral Inclusions. Nelson EV, Schmidt KM, Deflube LR, Doganay S, Banadyga L, Olejnik J, Hume AJ, Ryabchikova E, Ebihara H, Kedersha N, Ha T, Muhlberger E. J Virol. 2016 Jul 27;90(16):7268-84. doi: 10.1128/JVI.00459-16. Print 2016 Aug 15. 10.1128/JVI.00459-16 PubMed 27252530