Skip to main content
Addgene

pKSJ331
(Plasmid #103063)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 103063 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone manufacturer
    NEB
  • Backbone size w/o insert (bp) 2686
  • Total vector size (bp) 4900
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    TG1
  • Growth instructions
    Use TG1 cells for expression. Induced colicin production with mitomycin C, 0.5 ug/ml
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Colicin E1 and E1 immunity protein
  • Species
    E. coli
  • Insert Size (bp)
    2100
  • GenBank ID
    J01566.1
  • Promoter colicin promotor from ColE1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer ggatatgatgtggtatctgat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert was cloned from ~base pair 5015 to ~500 of the circular ColE1 plasmid, where numbering begins within the colicin E1 gene. The ColE1 sequences include both the promoter for colicin E1 and for E1 immunity protein, which is transcribed in the opposite direction from the colicin gene. The cloned DNA does not include the intact kil (lysis protein) gene.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKSJ331 was a gift from Alan Finkelstein & Karen Jakes (Addgene plasmid # 103063 ; http://n2t.net/addgene:103063 ; RRID:Addgene_103063)
  • For your References section:

    Identification of channel-lining amino acid residues in the hydrophobic segment of colicin Ia. Kienker PK, Jakes KS, Finkelstein A. J Gen Physiol. 2008 Dec;132(6):693-707. doi: 10.1085/jgp.200810042. 10.1085/jgp.200810042 PubMed 19029376