pKSJ331
(Plasmid
#103063)
-
PurposeExpresses colicin E1 and E1 immunity protein without E1 lysis (kil) gene
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 103063 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 2686
- Total vector size (bp) 4900
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)TG1
-
Growth instructionsUse TG1 cells for expression. Induced colicin production with mitomycin C, 0.5 ug/ml
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameColicin E1 and E1 immunity protein
-
SpeciesE. coli
-
Insert Size (bp)2100
-
GenBank IDJ01566.1
- Promoter colicin promotor from ColE1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer ggatatgatgtggtatctgat (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert was cloned from ~base pair 5015 to ~500 of the circular ColE1 plasmid, where numbering begins within the colicin E1 gene. The ColE1 sequences include both the promoter for colicin E1 and for E1 immunity protein, which is transcribed in the opposite direction from the colicin gene. The cloned DNA does not include the intact kil (lysis protein) gene.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKSJ331 was a gift from Alan Finkelstein & Karen Jakes (Addgene plasmid # 103063 ; http://n2t.net/addgene:103063 ; RRID:Addgene_103063) -
For your References section:
Identification of channel-lining amino acid residues in the hydrophobic segment of colicin Ia. Kienker PK, Jakes KS, Finkelstein A. J Gen Physiol. 2008 Dec;132(6):693-707. doi: 10.1085/jgp.200810042. 10.1085/jgp.200810042 PubMed 19029376