Skip to main content
Addgene

TIA1 RRM-mCherry-iLIDx6
(Plasmid #103782)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 103782 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmCherry-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4717
  • Total vector size (bp) 8174
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TIA1 RRM-mCherry-iLIDx6
  • Species
    Synthetic
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer GGAGGTCTATATAAGCAGAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TIA1 RRM-mCherry-iLIDx6 was a gift from Takanari Inoue (Addgene plasmid # 103782 ; http://n2t.net/addgene:103782 ; RRID:Addgene_103782)
  • For your References section:

    Intracellular production of hydrogels and synthetic RNA granules by multivalent molecular interactions. Nakamura H, Lee AA, Afshar AS, Watanabe S, Rho E, Razavi S, Suarez A, Lin YC, Tanigawa M, Huang B, DeRose R, Bobb D, Hong W, Gabelli SB, Goutsias J, Inoue T. Nat Mater. 2017 Nov 6. pii: nmat5006. doi: 10.1038/nmat5006. 10.1038/nmat5006 PubMed 29115293