pUDP013
(Plasmid
#103873)
-
PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting ADE2 from Ogataea (para)polymorpha
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 103873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUDP002
-
Backbone manufacturerJuergens H et al. Genome editing in Kluyveromyces and Ogataea yeasts using a broad-host-range Cas9/gRNA expression plasmid
- Backbone size w/o insert (bp) 10046
- Total vector size (bp) 10237
-
Vector typeYeast Expression, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
-
gRNA/shRNA sequenceCAAATTCCAGCTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCCTGGAATTGATCT GCTTGGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTG AAAAAGTGGCACCGAGTCGGTGCTTTTGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCC GGCTGGGCAACATGCTTCGGCATGGCGAATGGGAC
-
SpeciesOgataea (para)polymorpha
-
GenBank IDXM_014078618
- Promoter ScTDH3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GAACAGGGGCACAAACAGGC
- 3′ sequencing primer CTAAGAACTATGCGAGGACACGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byA patent describing use of the panARSOPT sequence used in pUDP series is pending (Pan-yeast autonomously replicating sequence WO 2014131056 A1). The legal status of Cas9 application is not yet sorted out The Spcas9D147Y P411T gene presents on pUDP013 is derived from pCT (Plasmid #60620) obtained from Addgene under Material TransferAgreement Instructions (Order 211742-our reference TNW15.216)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUDP013 was a gift from Jean-Marc Daran (Addgene plasmid # 103873 ; http://n2t.net/addgene:103873 ; RRID:Addgene_103873) -
For your References section:
Genome editing in Kluyveromyces and Ogataea yeasts using a broad-host-range Cas9/gRNA co-expression plasmid. Juergens H, Varela JA, Gorter de Vries AR, Perli T, Gast VJM, Gyurchev NY, Rajkumar AS, Mans R, Pronk JT, Morrissey JP, Daran JG. FEMS Yeast Res. 2018 May 1;18(3). pii: 4847887. doi: 10.1093/femsyr/foy012. 10.1093/femsyr/foy012 PubMed 29438517