pEB2-mRFP1*
(Plasmid
#104000)
-
PurposePlasmid encoding mRFP1*
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104000 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEB2
- Backbone size w/o insert (bp) 3224
- Total vector size (bp) 3932
-
Modifications to backboneSee "Notes On Plasmids In This Collection"
-
Vector typeBacterial Expression ; Low copy
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)MG1655
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemRFP1*
-
Alt namemRFP1star
-
SpeciesSynthetic
-
Insert Size (bp)708
-
MutationMutations relative to DsRed (MSKGEE NNLAVIKEF...T21S, H41T, N42Q, V44A, V71A, K83L, C117E, F124L, I125R, V127T, L150M, R153E, V156A, H162K, K163M, A164R, L174D, V175A, F177V, S179T, I180T, Y192A, Y194K, V195T, S197I, T217A, H222S, L223T, F224G … EGRHSTG GMDELYK)
- Promoter proC
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGTATCACGAGGCCCTTTC
- 3′ sequencing primer AAAGGGAAAACTGTCCATATGCAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This FP derives from DsRed. Please see "Notes On Plasmids In This Collection" document for further details and references.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEB2-mRFP1* was a gift from Philippe Cluzel (Addgene plasmid # 104000 ; http://n2t.net/addgene:104000 ; RRID:Addgene_104000) -
For your References section:
Systematic characterization of maturation time of fluorescent proteins in living cells. Balleza E, Kim JM, Cluzel P. Nat Methods. 2018 Jan;15(1):47-51. doi: 10.1038/nmeth.4509. Epub 2017 Nov 20. 10.1038/nmeth.4509 PubMed 29320486