- 
            PurposePlasmid encoding mKate2
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104009 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepEB2
 - Backbone size w/o insert (bp) 3224
 - Total vector size (bp) 3920
 - 
              Modifications to backboneSee "Notes On Plasmids In This Collection"
 - 
              Vector typeBacterial Expression ; Low copy
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)MG1655
 - 
            Copy numberLow Copy
 
Gene/Insert
- 
                Gene/Insert namemKate2
 - 
                    SpeciesSynthetic
 - 
                  Insert Size (bp)696
 - 
                  MutationMutations relative to eqFP578 (R32G, K42R, V45A, L79F, I93V, N112D, I115L, N122R, S131P, N143S, M146T, R155E, H157R, S158A, Q159D, Y169H, H171I, S173N, F174L, F192V, H193Y, F194Y, H197R, M216V, K220R)
 - Promoter proC
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer GCGTATCACGAGGCCCTTTC
 - 3′ sequencing primer AAAGGGAAAACTGTCCATATGCAC (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 - 
            Articles Citing this Plasmid
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
Depositor Comments
This FP derives from eqFP578. Please see "Notes On Plasmids In This Collection" document for further details and references.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pEB2-mKate2 was a gift from Philippe Cluzel (Addgene plasmid # 104009 ; http://n2t.net/addgene:104009 ; RRID:Addgene_104009) - 
                
For your References section:
Systematic characterization of maturation time of fluorescent proteins in living cells. Balleza E, Kim JM, Cluzel P. Nat Methods. 2018 Jan;15(1):47-51. doi: 10.1038/nmeth.4509. Epub 2017 Nov 20. 10.1038/nmeth.4509 PubMed 29320486