LZF70: Cre-off hSyn-QuasAr3-dark Citrine (FAS)
(Plasmid
#104117)
-
PurposesynOptopatch construct
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104117 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonefsyn-cre-off
- Backbone size w/o insert (bp) 8000
- Total vector size (bp) 10275
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameQuasAr3-dark Citrine
-
SpeciesSynthetic
-
Insert Size (bp)1800
- Promoter human synapsin I
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGAGAGCGCAGTCGAGAAG
- 3′ sequencing primer tcacaaattttgtaatccag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LZF70: Cre-off hSyn-QuasAr3-dark Citrine (FAS) was a gift from Adam Cohen (Addgene plasmid # 104117 ; http://n2t.net/addgene:104117 ; RRID:Addgene_104117) -
For your References section:
All-optical synaptic electrophysiology probes mechanism of ketamine-induced disinhibition. Fan LZ, Nehme R, Adam Y, Jung ES, Wu H, Eggan K, Arnold DB, Cohen AE. Nat Methods. 2018 Oct;15(10):823-831. doi: 10.1038/s41592-018-0142-8. Epub 2018 Oct 1. 10.1038/s41592-018-0142-8 PubMed 30275587