LZF1604V2: CAG-spine-jRGECO1a-P2A-QuasAr3-dark Citrine
(Plasmid
#104122)
-
PurposesynOptopatch construct
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104122 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV-CAG-FLEX
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 10096
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namespine-jRGECO1a-P2A-QuasAr-dark Citrine
-
SpeciesSynthetic
-
Insert Size (bp)4000
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcaacgtgctggttattgtg
- 3′ sequencing primer ggcggacttgaagaagtcgt
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byJanelia Research Campus
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LZF1604V2: CAG-spine-jRGECO1a-P2A-QuasAr3-dark Citrine was a gift from Adam Cohen (Addgene plasmid # 104122 ; http://n2t.net/addgene:104122 ; RRID:Addgene_104122) -
For your References section:
All-optical synaptic electrophysiology probes mechanism of ketamine-induced disinhibition. Fan LZ, Nehme R, Adam Y, Jung ES, Wu H, Eggan K, Arnold DB, Cohen AE. Nat Methods. 2018 Oct;15(10):823-831. doi: 10.1038/s41592-018-0142-8. Epub 2018 Oct 1. 10.1038/s41592-018-0142-8 PubMed 30275587