pBL119-2
(Plasmid
#104336)
-
PurposeExpresses thsR from a TetR regulated promoter under ATC control. Expresses sfGFP from a thsR regulated promoter. Expresses mCherry from a constituative promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104336 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneColE1
- Total vector size (bp) 5531
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB10b
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameThiosulfate response regulator
-
Alt nameThsR
-
SpeciesShewanella halifaxensis HAW-EB4
-
Insert Size (bp)612
-
GenBank IDABZ77676
- Promoter PLTetO1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer CGTCTAAGAAACCATTATTATCATGACATTAAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBL119-2 was a gift from Jeffrey Tabor (Addgene plasmid # 104336 ; http://n2t.net/addgene:104336 ; RRID:Addgene_104336) -
For your References section:
Phosphatase activity tunes two-component system sensor detection threshold. Landry BP, Palanki R, Dyulgyarov N, Hartsough LA, Tabor JJ. Nat Commun. 2018 Apr 12;9(1):1433. doi: 10.1038/s41467-018-03929-y. 10.1038/s41467-018-03929-y PubMed 29650958