PIA900
(Plasmid
#104401)
-
PurposePolycistronic vector for expression of E. coli core RNAP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104401 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET
-
Backbone manufacturerNovagen
- Total vector size (bp) 15247
-
Vector typeBacterial Expression ; E. coli expression vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerpoA, B, C, and Z
-
SpeciesE. coli
- Promoter T7
-
Tag
/ Fusion Protein
- encodes a C-terminally His-tagged rpoC which can be removed using TEV protease. (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (unknown if destroyed)
- 3′ cloning site Stu1 (unknown if destroyed)
- 5′ sequencing primer T7 TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pIA900 (rpoA, B, C, and Z) encodes a C-terminally His-tagged β′ which can be removed using TEV protease. Linker with TEV-His10 cloned between NheI and StuI sites of pIA787; NheI site is gone
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PIA900 was a gift from Irina Artsimovitch (Addgene plasmid # 104401 ; http://n2t.net/addgene:104401 ; RRID:Addgene_104401) -
For your References section:
Purification of bacterial RNA polymerase: tools and protocols. Svetlov V, Artsimovitch I. Methods Mol Biol. 2015;1276:13-29. doi: 10.1007/978-1-4939-2392-2_2. 10.1007/978-1-4939-2392-2_2 PubMed 25665556