pKL05
(Plasmid
#104429)
-
Purposesuper Ecliptic pHluorin in yeast expression vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104429 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep416
- Backbone size w/o insert (bp) 6500
- Total vector size (bp) 746
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSuper Ecliptic pHluorin
-
Alt nameSEP
-
SpeciesSynthetic
-
Insert Size (bp)750
- Promoter Tef1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCTTTCGATGACCTCCCATTG
- 3′ sequencing primer CTTCAGGTTGTCTAACTCCTTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byOrdered as gBlock from IDT
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKL05 was a gift from Joel Kralj (Addgene plasmid # 104429 ; http://n2t.net/addgene:104429 ; RRID:Addgene_104429) -
For your References section:
Live Cell Imaging Reveals pH Oscillations in Saccharomyces cerevisiae During Metabolic Transitions. Dodd BJT, Kralj JM. Sci Rep. 2017 Oct 24;7(1):13922. doi: 10.1038/s41598-017-14382-0. 10.1038/s41598-017-14382-0 [pii] PubMed 29066766