Skip to main content

pSpCas9 (BB)-2A-GFP gamma-tubulin sg
(Plasmid #104437)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104437 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9 (BB)-2A-GFP
  • Backbone manufacturer
    Dr. Zhang
  • Backbone size w/o insert (bp) 9289
  • Total vector size (bp) 9309
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gamma-tubulin sgRNA
  • Alt name
    NA
  • gRNA/shRNA sequence
    TACAGTTGGGCCAGTGCGGC
  • Species
    H. sapiens (human)
  • GenBank ID
  • Tag / Fusion Protein
    • The gamma-tubulin sgRNA is coexpressed with 3xFLAG-Cas9-GFP

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone was a gift from Dr. Zhang
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9 (BB)-2A-GFP gamma-tubulin sg was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 104437 ; http://n2t.net/addgene:104437 ; RRID:Addgene_104437)
  • For your References section:

    Characterization of gamma-tubulin filaments in mammalian cells. Lindstrom L, Alvarado-Kristensson M. Biochim Biophys Acta. 2017 Oct 16. pii: S0167-4889(17)30283-5. doi: 10.1016/j.bbamcr.2017.10.008. 10.1016/j.bbamcr.2017.10.008 PubMed 29050966