LI E-F Tfd
(Plasmid
#104520)
-
PurposeLI terminator module
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104520 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57
-
Backbone manufacturerParniske lab
- Backbone size w/o insert (bp) 2458
-
Vector typeCloning vector
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTfd terminator
-
Insert Size (bp)190
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GGGTTTTCCCAGTCACGACGT
- 3′ sequencing primer GAGCGGATAACAATTTCACACAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LI E-F Tfd was a gift from Thomas Lahaye (Addgene plasmid # 104520 ; http://n2t.net/addgene:104520 ; RRID:Addgene_104520) -
For your References section:
A modular toolbox for Golden-Gate-based plasmid assembly streamlines generation of Ralstonia solanacearum species complex knockout strains and multi-cassette complementation constructs. Wu D, Schandry N, Lahaye T. Mol Plant Pathol. 2017 Oct 27. doi: 10.1111/mpp.12632. 10.1111/mpp.12632 PubMed 29077245