Skip to main content
Addgene

LI F-G Tet
(Plasmid #104524)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104524 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC57
  • Backbone manufacturer
    Parniske lab
  • Backbone size w/o insert (bp) 2458
  • Vector type
    Cloning vector
  • Selectable markers
    Tetracycline

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tetracycline resistance gene
  • Insert Size (bp)
    1956

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer GGGTTTTCCCAGTCACGACGT
  • 3′ sequencing primer GAGCGGATAACAATTTCACACAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LI F-G Tet was a gift from Thomas Lahaye (Addgene plasmid # 104524 ; http://n2t.net/addgene:104524 ; RRID:Addgene_104524)
  • For your References section:

    A modular toolbox for Golden-Gate-based plasmid assembly streamlines generation of Ralstonia solanacearum species complex knockout strains and multi-cassette complementation constructs. Wu D, Schandry N, Lahaye T. Mol Plant Pathol. 2017 Oct 27. doi: 10.1111/mpp.12632. 10.1111/mpp.12632 PubMed 29077245