PM PKA Reporter
(Plasmid
#104551)
-
PurposeExpresses Lyn-mTurquoise2-VASP at the plasma membrane of mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEF1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 5736
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLyn-mTurquoise2-VASP 148 - 164
-
SpeciesSynthetic
-
Insert Size (bp)855
- Promoter EF1 alpha
-
Tag
/ Fusion Protein
- mTurquoise 2, HA tag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AGATCTCGAGCTCAAGCTTC
- 3′ sequencing primer GTAACCATTATAAGCTGCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasma membrane targeted PKA reporter. Lyn N-terminal myristoylation sequence fused to N-terminus of mTurquoise2 and VASP 148-164 fused to C terminus of fluorescent protein.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PM PKA Reporter was a gift from David Lawrence (Addgene plasmid # 104551 ; http://n2t.net/addgene:104551 ; RRID:Addgene_104551) -
For your References section:
Design and Profiling of a Subcellular Targeted Optogenetic cAMP-Dependent Protein Kinase. O'Banion CP, Priestman MA, Hughes RM, Herring LE, Capuzzi SJ, Lawrence DS. Cell Chem Biol. 2017 Oct 25. pii: S2451-9456(17)30355-0. doi: 10.1016/j.chembiol.2017.09.011. 10.1016/j.chembiol.2017.09.011 PubMed 29104065