-
Purposebacterial expression of Exonuclease I
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104552 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET14b
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 4671
- Total vector size (bp) 6119
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameExonuclease I
-
SpeciesE.coli
-
Insert Size (bp)1448
-
Entrez GenesbcB (a.k.a. b2011, ECK2005, JW1993, cpeA, xonA)
- Promoter T7
-
Tag
/ Fusion Protein
- 6X-His tag followed by thrombin site
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site BamH1 (unknown if destroyed)
- 5′ sequencing primer T7-F TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET14b – E. coli Exonuclease I was a gift from Charles Bell (Addgene plasmid # 104552 ; http://n2t.net/addgene:104552 ; RRID:Addgene_104552) -
For your References section:
Crystal structures of Escherichia coli exonuclease I in complex with single-stranded DNA provide insights into the mechanism of processive digestion. Korada SK, Johns TD, Smith CE, Jones ND, McCabe KA, Bell CE. Nucleic Acids Res. 2013 Jun;41(11):5887-97. doi: 10.1093/nar/gkt278. Epub 2013 Apr 22. 10.1093/nar/gkt278 PubMed 23609540