Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #104592)


Item Catalog # Description Quantity Price (USD)
Plasmid 104592 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 3001
  • Vector type
    cloning vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    HIV-1 late reverse transcripts
  • Species
    HIV-1 virus

Cloning Information

  • Cloning method TOPO Cloning
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid may be used as a qPCR standard for the measure of HIV-1 virus. It encodes a short fragment of the HIV-1 genome corresponding to 557-699 bp in the HXB2 reference strain sequence. This sequence corresponds to 674-816 bp in reverse in the Addgene sequence file. It may be amplified with primers MH531 (5' TGTGTGCCCGTCTGTTGTGT), MH532 (5' GAGTCCTGCGTCGAGAGAGC), and Taqman probe LRT-P (5' CAGTGGCGCCCGAACAGGGA)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pG-HIV-LRT was a gift from Kristine Yoder (Addgene plasmid # 104592 ; ; RRID:Addgene_104592)
  • For your References section:

    Real-time quantitative PCR and fast QPCR have similar sensitivity and accuracy with HIV cDNA late reverse transcripts and 2-LTR circles. Yoder KE, Fishel R. J Virol Methods. 2008 Nov;153(2):253-6. doi: 10.1016/j.jviromet.2008.07.032. Epub 2008 Sep 17. 10.1016/j.jviromet.2008.07.032 PubMed 18762215