pJC-elav1.8kb-TALE1-VP64-P10
(Plasmid
#104609)
-
PurposeExpresses TALE1 under the control of a 1.8kb elav enhancer element
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104609 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJC-20xUAS-TALE1-VP64-P10
-
Backbone manufacturerTudor A. Fulga
- Backbone size w/o insert (bp) 11295
- Total vector size (bp) 13146
-
Modifications to backbone20xUAS replaced with 1.8kb elav enhancer element
-
Vector typeInsect Expression, TALEN
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name1.8kb elav enhancer element
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)1851
-
GenBank IDNM_001258518.3
-
Entrez Geneelav (a.k.a. Dmel_CG4262, 44C11, 9F8A9, CG4262, Dmel\CG4262, EC7, EG:65F1.2, ELAV, ELav, END1-2, ElaV, Elav, Elav-9F8A9, dHuR, elav-1, elav-2, elav-3, fliJ, l(1)1Be, l(1)EC7, l(1)G0031, l(1)G0319, weg)
- Promoter hsp70
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer CGGTGATTCATTCTGCTAACCA
- 3′ sequencing primer AGGGTTAGTCGTTTCGGTGTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJC-elav1.8kb-TALE1-VP64-P10 was a gift from Tudor Fulga (Addgene plasmid # 104609 ; http://n2t.net/addgene:104609 ; RRID:Addgene_104609) -
For your References section:
A multiplexable TALE-based binary expression system for in vivo cellular interaction studies. Toegel M, Azzam G, Lee EY, Knapp DJHF, Tan Y, Fa M, Fulga TA. Nat Commun. 2017 Nov 21;8(1):1663. doi: 10.1038/s41467-017-01592-3. 10.1038/s41467-017-01592-3 PubMed 29162808