Skip to main content
Addgene

pJC-mhc2.4kb-TALE3-VP64-P10
(Plasmid #104611)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104611 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJC-20xUAS-TALE3-VP64-P10
  • Backbone manufacturer
    Tudor A. Fulga
  • Backbone size w/o insert (bp) 11291
  • Total vector size (bp) 13685
  • Modifications to backbone
    20xUAS replaced with 2.4kb mhc enhancer element
  • Vector type
    Insect Expression, TALEN

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    2.4kb mhc enhancer element
  • Species
    D. melanogaster (fly)
  • Insert Size (bp)
    2394
  • GenBank ID
    NM_165190.4
  • Entrez Gene
    Mhc (a.k.a. Dmel_CG17927, Bsh, CG17927, DROMHC, Dm II, DmMHC, Dmel\CG17927, DroMII, Ifm(2)2, Ifm(2)RU1, MHC, MRP, Mhc36B, Mrp, MyHC, Myo, Myo6, Nup, Sht, Stp, chr2L:16765388..16765564, chr2L:16781880..16782040, ifm(2)2, ifm(2)RU1, ifm(2)RU2, l(2)36Ae, l(2)M66, l(2)k10423, mMHC, mhc, sMHC)
  • Promoter hsp70

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer CGGTGATTCATTCTGCTAACCA
  • 3′ sequencing primer AGGGTTAGTCGTTTCGGTGTGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The mhc enhancer element was cloned from plasmid pFS209_CaSpeR_Mhc-GAL4 (gift from Frank Schnorrer) published in: Klein, P. et al. Ret rescues mitochondrial morphology and muscle degeneration of Drosophila Pink1 mutants. EMBO J 33, 341-355 (2014).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJC-mhc2.4kb-TALE3-VP64-P10 was a gift from Tudor Fulga (Addgene plasmid # 104611 ; http://n2t.net/addgene:104611 ; RRID:Addgene_104611)
  • For your References section:

    A multiplexable TALE-based binary expression system for in vivo cellular interaction studies. Toegel M, Azzam G, Lee EY, Knapp DJHF, Tan Y, Fa M, Fulga TA. Nat Commun. 2017 Nov 21;8(1):1663. doi: 10.1038/s41467-017-01592-3. 10.1038/s41467-017-01592-3 PubMed 29162808