pJFRC81-3xVAS3-IVS-Syn21-GFP-P10
(Plasmid
#104614)
-
PurposeExpresses GFP upon binding of TALE3 to VAS3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104614 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJFRC81 (Plasmid #36432)
-
Backbone manufacturerGerald Rubin
- Backbone size w/o insert (bp) 8358
- Total vector size (bp) 8418
-
Modifications to backbone10xUAS replaced with 3xVAS3
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xVAS3
-
SpeciesSynthetic
-
Insert Size (bp)60
- Promoter hsp70
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NheI (destroyed during cloning)
- 5′ sequencing primer CGGTGATTCATTCTGCTAACCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's sequencing results found a G->A mutation in the 2nd VAS3 sequence. The depositing lab states that this mutation should not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJFRC81-3xVAS3-IVS-Syn21-GFP-P10 was a gift from Tudor Fulga (Addgene plasmid # 104614 ; http://n2t.net/addgene:104614 ; RRID:Addgene_104614) -
For your References section:
A multiplexable TALE-based binary expression system for in vivo cellular interaction studies. Toegel M, Azzam G, Lee EY, Knapp DJHF, Tan Y, Fa M, Fulga TA. Nat Commun. 2017 Nov 21;8(1):1663. doi: 10.1038/s41467-017-01592-3. 10.1038/s41467-017-01592-3 PubMed 29162808