pJFRC81-3xVAS1-Syn21-Citrine-HA-P10-3xVAS4-Syn21-FLAG-Cerulean-P10
(Plasmid
#104619)
-
PurposeExpresses HA tagged Citrine or FLAG tagged Cerulean upon binding of TALE1 to VAS1 or TALE4 to VAS4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104619 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJFRC81-3xVAS1-Syn21-Citrine-HA-P10
-
Backbone manufacturerTudor A. Fulga
- Backbone size w/o insert (bp) 8576
- Total vector size (bp) 10332
-
Modifications to backbone3xVAS4-hsp70-Syn21-FLAG-mCerulean-P10 inserted in reverse orientation
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3xVAS4-hsp70-Syn21-FLAG-Cerulean-P10
-
SpeciesSynthetic
-
Insert Size (bp)1756
- Promoter hsp70
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCCCATTTGAACTTCTGAATTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene's sequencing results found a frameshift at D234 of Cerulean. The depositing lab states that this mutation does not affect fluorophore expression, as it is located at the C-terminus of the ORF.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJFRC81-3xVAS1-Syn21-Citrine-HA-P10-3xVAS4-Syn21-FLAG-Cerulean-P10 was a gift from Tudor Fulga (Addgene plasmid # 104619 ; http://n2t.net/addgene:104619 ; RRID:Addgene_104619) -
For your References section:
A multiplexable TALE-based binary expression system for in vivo cellular interaction studies. Toegel M, Azzam G, Lee EY, Knapp DJHF, Tan Y, Fa M, Fulga TA. Nat Commun. 2017 Nov 21;8(1):1663. doi: 10.1038/s41467-017-01592-3. 10.1038/s41467-017-01592-3 PubMed 29162808