Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUG-UBC4
(Plasmid #104668)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 104668 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pICH41308
  • Backbone manufacturer
    self-made
  • Backbone size w/o insert (bp) 2251
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AtUBC4
  • Alt name
    AT5G41340
  • Species
    A. thaliana (mustard weed)
  • Entrez Gene
    UBC4 (a.k.a. AT5G41340, ATUBC4, MYC6.5, MYC6_5, UBIQUITIN CONJUGATING ENZYME 4, ubiquitin conjugating enzyme 4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer moclof, agcgaggaagcggaagagcg
  • 3′ sequencing primer moclor, gccacctgacgtctaagaaacc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

release insert with BsaI and clone to Level 1 cloning vector

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUG-UBC4 was a gift from Marco Trujillo (Addgene plasmid # 104668 ; http://n2t.net/addgene:104668 ; RRID:Addgene_104668)
  • For your References section:

    UbiGate: a synthetic biology toolbox to analyse ubiquitination. Kowarschik K, Hoehenwarter W, Marillonnet S, Trujillo M. New Phytol. 2018 Mar;217(4):1749-1763. doi: 10.1111/nph.14900. Epub 2017 Nov 30. 10.1111/nph.14900 PubMed 29194629