Skip to main content

pUG-146
(Plasmid #104712)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104712 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pICH41308
  • Backbone manufacturer
    self-made
  • Backbone size w/o insert (bp) 2251
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AvrPtoB 1-401
  • Insert Size (bp)
    1211
  • Mutation
    truncated version AA 1-401

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer moclof, agcgaggaagcggaagagcg
  • 3′ sequencing primer moclor, gccacctgacgtctaagaaacc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

release insert with BsaI and clone to Level 1 cloning vector

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUG-146 was a gift from Marco Trujillo (Addgene plasmid # 104712 ; http://n2t.net/addgene:104712 ; RRID:Addgene_104712)
  • For your References section:

    UbiGate: a synthetic biology toolbox to analyse ubiquitination. Kowarschik K, Hoehenwarter W, Marillonnet S, Trujillo M. New Phytol. 2018 Mar;217(4):1749-1763. doi: 10.1111/nph.14900. Epub 2017 Nov 30. 10.1111/nph.14900 PubMed 29194629