Skip to main content

pTol1:uas-myc-act-map2k2b-2a-tdTomato
(Plasmid #104721)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104721 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Tol1
  • Vector type
    zebrafish transposon

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    activated map2k2b
  • Species
    D. rerio (zebrafish)
  • Mutation
    serines 221 and 225 to aspartic acid
  • Entrez Gene
    map2k2b (a.k.a. zgc:172250)
  • Promoter 10xUAS
  • Tags / Fusion Proteins
    • myc tag (N terminal on insert)
    • 2A-tdTomato (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GTAAAACGACGGCCAGT
  • 3′ sequencing primer GCGGATAACAATTTCACACAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTol1:uas-myc-act-map2k2b-2a-tdTomato was a gift from Nathan Lawson (Addgene plasmid # 104721 ; http://n2t.net/addgene:104721 ; RRID:Addgene_104721)
  • For your References section:

    Vegfc acts through ERK to induce sprouting and differentiation of trunk lymphatic progenitors. Shin M, Male I, Beane TJ, Villefranc JA, Kok FO, Zhu LJ, Lawson ND. Development. 2016 Oct 15;143(20):3785-3795. Epub 2016 Sep 12. 10.1242/dev.137901 PubMed 27621059