pTol1:uas-myc-act-map2k2b-2a-tdTomato
(Plasmid
#104721)
-
PurposeUAS-driven expression of activated MEK
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTol1
-
Vector typezebrafish transposon
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameactivated map2k2b
-
SpeciesD. rerio (zebrafish)
-
Mutationserines 221 and 225 to aspartic acid
-
Entrez Genemap2k2b (a.k.a. zgc:172250)
- Promoter 10xUAS
-
Tags
/ Fusion Proteins
- myc tag (N terminal on insert)
- 2A-tdTomato (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GTAAAACGACGGCCAGT
- 3′ sequencing primer GCGGATAACAATTTCACACAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTol1:uas-myc-act-map2k2b-2a-tdTomato was a gift from Nathan Lawson (Addgene plasmid # 104721 ; http://n2t.net/addgene:104721 ; RRID:Addgene_104721) -
For your References section:
Vegfc acts through ERK to induce sprouting and differentiation of trunk lymphatic progenitors. Shin M, Male I, Beane TJ, Villefranc JA, Kok FO, Zhu LJ, Lawson ND. Development. 2016 Oct 15;143(20):3785-3795. Epub 2016 Sep 12. 10.1242/dev.137901 PubMed 27621059