pSC14
(Plasmid
#104788)
-
PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr2g044580 (ERDJ2). Also expresses Cas9 from AtUBQ10 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104788 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSC218
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMedtr2g044580
-
Alt nameERDJ2
-
gRNA/shRNA sequenceggtactgaaggttagcgacgag, gaatattgatggggcatctggg
Cloning Information
- Cloning method Gateway Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
112-15:5.1. Alternative name of plasmid: pSG218UG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSC14 was a gift from Nevin Young (Addgene plasmid # 104788 ; http://n2t.net/addgene:104788 ; RRID:Addgene_104788) -
For your References section:
Validating Genome-Wide Association Candidates Controlling Quantitative Variation in Nodulation. Curtin SJ, Tiffin P, Guhlin J, Trujillo DI, Burghart LT, Atkins P, Baltes NJ, Denny R, Voytas DF, Stupar RM, Young ND. Plant Physiol. 2017 Feb;173(2):921-931. doi: 10.1104/pp.16.01923. Epub 2017 Jan 5. 10.1104/pp.16.01923 PubMed 28057894