Skip to main content

pSC22
(Plasmid #104796)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104796 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSC218
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Medtr2g101120, Medtr2g101130
  • Alt name
    Acre1
  • gRNA/shRNA sequence
    ttccaccatcaccacaaccag, ggatttgtactacgagtttgg

Cloning Information

  • Cloning method Gateway Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

112-31:15.1. Alternative name of plasmid: pSG218UG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSC22 was a gift from Nevin Young (Addgene plasmid # 104796 ; http://n2t.net/addgene:104796 ; RRID:Addgene_104796)
  • For your References section:

    Validating Genome-Wide Association Candidates Controlling Quantitative Variation in Nodulation. Curtin SJ, Tiffin P, Guhlin J, Trujillo DI, Burghart LT, Atkins P, Baltes NJ, Denny R, Voytas DF, Stupar RM, Young ND. Plant Physiol. 2017 Feb;173(2):921-931. doi: 10.1104/pp.16.01923. Epub 2017 Jan 5. 10.1104/pp.16.01923 PubMed 28057894