pSC44
(Plasmid
#104818)
-
PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from AtUBQ10 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 104818 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSC218
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGlyma.04g057400
-
Alt nameDcl3a-1
-
gRNA/shRNA sequenceaaattgaatgatatctgtgg
Cloning Information
- Cloning method Gateway Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
111-212:3.1. Alternative name of plasmid: pSG218RG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSC44 was a gift from Robert Stupar (Addgene plasmid # 104818 ; http://n2t.net/addgene:104818 ; RRID:Addgene_104818) -
For your References section:
CRISPR/Cas9 and TALENs generate heritable mutations for genes involved in small RNA processing of Glycine max and Medicago truncatula. Curtin SJ, Xiong Y, Michno JM, Campbell BW, Stec AO, Cermak T, Starker C, Voytas DF, Eamens AL, Stupar RM. Plant Biotechnol J. 2017 Oct 31. doi: 10.1111/pbi.12857. 10.1111/pbi.12857 PubMed 29087011