Skip to main content

pSC51
(Plasmid #104825)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104825 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSC218
  • Vector type
    Plant Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Glyma.12g075700, Glyma.11g145900
  • Alt name
    Drb2ab
  • gRNA/shRNA sequence
    tgccaagaataagaaacaag, ttagctggaatcatgtttac

Cloning Information

  • Cloning method Gateway Cloning

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

112-277:2.1. Alternative name of plasmid: pSG218GG. Please note that this plasmid contains two (ttagctggaatcatgtttac) gRNA cassettes. The plasmid still functions as described in the publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSC51 was a gift from Robert Stupar (Addgene plasmid # 104825 ; http://n2t.net/addgene:104825 ; RRID:Addgene_104825)
  • For your References section:

    CRISPR/Cas9 and TALENs generate heritable mutations for genes involved in small RNA processing of Glycine max and Medicago truncatula. Curtin SJ, Xiong Y, Michno JM, Campbell BW, Stec AO, Cermak T, Starker C, Voytas DF, Eamens AL, Stupar RM. Plant Biotechnol J. 2017 Oct 31. doi: 10.1111/pbi.12857. 10.1111/pbi.12857 PubMed 29087011