Skip to main content

pET28a-mxLOX1
(Plasmid #104975)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 104975 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET 28a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5369
  • Total vector size (bp) 7498
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MXAN_1745
  • Alt name
    mxLOX1
  • Species
    Myxococcus xanthus
  • Insert Size (bp)
    2148
  • GenBank ID
    ABF 86480.1
  • Entrez Gene
    MXAN_1745 (a.k.a. MXAN_1745)
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • 6 histidine tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGATTCATGAGCGCGAGTGTGA
  • 3′ sequencing primer GCGGCCGCTTAGATATTGATGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene sequencing data found H193Q in the MXAN_1745 translation, that does not affect protein function

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-mxLOX1 was a gift from Deokkun Oh (Addgene plasmid # 104975 ; http://n2t.net/addgene:104975 ; RRID:Addgene_104975)