Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #127738)


Item Catalog # Description Quantity Price (USD)
Plasmid 127738 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    pyruvate carboxylase
  • Alt name
  • Species
    S. cerevisiae (budding yeast), Synthetic
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    PYC1 (a.k.a. YGL062W)
  • Promoter Pfba1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer AACGTTGTCCAGGTTTGTATCC
  • 3′ sequencing primer AGGTACAACAAGCACGACCG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

PYC transcription unit with pathway position 5 homology arms, compatible with 5' position 4 and 3' position 6 homology arm. Sequencing primers are also the primers for amplifying DNA for integration into the S. cerevisiae genome.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDSM-de-Pfba1-PYC-Trpl15a was a gift from Christopher Voigt (Addgene plasmid # 127738 ; ; RRID:Addgene_127738)
  • For your References section:

    Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast. Young EM, Zhao Z, Gielesen BEM, Wu L, Benjamin Gordon D, Roubos JA, Voigt CA. Metab Eng. 2018 Jul;48:33-43. doi: 10.1016/j.ymben.2018.05.002. Epub 2018 May 9. 10.1016/j.ymben.2018.05.002 PubMed 29753070