10xUAS-GFP-DD
(Plasmid
#104989)
-
PurposeExpresses GFP fused with destabilizing domain (DD) downstream of a 10XUAS sequence.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 104989 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJFRC-MUH
- Total vector size (bp) 9083
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTMP-inducible destabilized GFP (GFP-DD)
-
Alt nameGFP-ecDHFR
-
SpeciesD. melanogaster (fly)
-
Tag
/ Fusion Protein
- DD (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer hsp70 F: GAGCGCCGGAGTATAAATAGAG
- 3′ sequencing primer p10 R: CGGCCAAATGTTAAACTTGGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
10xUAS-GFP-DD was a gift from Jing-W Wang (Addgene plasmid # 104989 ; http://n2t.net/addgene:104989 ; RRID:Addgene_104989) -
For your References section:
A versatile genetic tool for post-translational control of gene expression in Drosophila melanogaster. Sethi S, Wang JW. Elife. 2017 Nov 15;6. pii: e30327. doi: 10.7554/eLife.30327. 10.7554/eLife.30327 PubMed 29140243