Skip to main content

pCAG-PDZD8HA_sh_resistant
(Plasmid #105006)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105006 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PDZD8
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3441
  • Mutation
    The sequence recognized by shPDZD8 (TRCN0000431056) is mutated
  • Entrez Gene
    Pdzd8 (a.k.a. A630041P07Rik, Pdzk8)
  • Promoter CAG
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ctacagctcctgggcaacgt
  • 3′ sequencing primer AAGATCTCAGTGGTATTTGTGAGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-PDZD8HA_sh_resistant was a gift from Franck Polleux (Addgene plasmid # 105006 ; http://n2t.net/addgene:105006 ; RRID:Addgene_105006)
  • For your References section:

    ER-mitochondria tethering by PDZD8 regulates Ca(2+) dynamics in mammalian neurons. Hirabayashi Y, Kwon SK, Paek H, Pernice WM, Paul MA, Lee J, Erfani P, Raczkowski A, Petrey DS, Pon LA, Polleux F. Science. 2017 Nov 3;358(6363):623-630. doi: 10.1126/science.aan6009. 10.1126/science.aan6009 PubMed 29097544