pCAG-PDZD8HA_sh_resistant
(Plasmid
#105006)
-
PurposeMammalian Expression of PDZD8, sh resistant
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105006 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePDZD8
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3441
-
MutationThe sequence recognized by shPDZD8 (TRCN0000431056) is mutated
-
Entrez GenePdzd8 (a.k.a. A630041P07Rik, Pdzk8)
- Promoter CAG
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctacagctcctgggcaacgt
- 3′ sequencing primer AAGATCTCAGTGGTATTTGTGAGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-PDZD8HA_sh_resistant was a gift from Franck Polleux (Addgene plasmid # 105006 ; http://n2t.net/addgene:105006 ; RRID:Addgene_105006) -
For your References section:
ER-mitochondria tethering by PDZD8 regulates Ca(2+) dynamics in mammalian neurons. Hirabayashi Y, Kwon SK, Paek H, Pernice WM, Paul MA, Lee J, Erfani P, Raczkowski A, Petrey DS, Pon LA, Polleux F. Science. 2017 Nov 3;358(6363):623-630. doi: 10.1126/science.aan6009. 10.1126/science.aan6009 PubMed 29097544