-
Purposepuro-selectable lentivirus vector for inducible expression of a UBAP2L-mCherry fusion protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105286 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLIX403
-
Backbone manufacturerAddgene plasmid 41393
- Backbone size w/o insert (bp) 9396
- Total vector size (bp) 11752
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUBAP2L
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3261
-
GenBank IDNM_014847.3
-
Entrez GeneUBAP2L (a.k.a. NICE-4, NICE4)
- Promoter TRE promoter, Tet ON
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer LNCX
- 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLIX403_UBAP2L_mCherry was a gift from Eugene Yeo (Addgene plasmid # 105286 ; http://n2t.net/addgene:105286 ; RRID:Addgene_105286) -
For your References section:
Context-Dependent and Disease-Specific Diversity in Protein Interactions within Stress Granules. Markmiller S, Soltanieh S, Server KL, Mak R, Jin W, Fang MY, Luo EC, Krach F, Yang D, Sen A, Fulzele A, Wozniak JM, Gonzalez DJ, Kankel MW, Gao FB, Bennett EJ, Lecuyer E, Yeo GW. Cell. 2018 Jan 25;172(3):590-604.e13. doi: 10.1016/j.cell.2017.12.032. 10.1016/j.cell.2017.12.032 PubMed 29373831