pEGFP Kind2 S181E
(Plasmid
#105312)
-
PurposeTo study altered downstream functions of phospholylation-site mimetic kindlin2
-
Depositing Lab
-
Depositing OrganizationNational Institute of Dental and Craniofacial Research (NIDCR)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105312 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 105312-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 105312-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-NV
-
Backbone manufacturermodified pEGFP-N1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKindlin2
-
Alt nameFERMT2
-
Alt namefermitin family member 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2100
-
MutationS181E
-
GenBank IDNM_006832
-
Entrez GeneFERMT2 (a.k.a. KIND2, MIG2, PLEKHC1, UNC112, UNC112B, mig-2)
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (unknown if destroyed)
- 3′ cloning site BamH1 (unknown if destroyed)
- 5′ sequencing primer GGGAAAAGAAGAGAACTTGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutation in Kindlin2 was introduced by using site-directed mutagenesis (Stratagene)
DNA (Catalog # 105312-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 105312-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP Kind2 S181E was a gift from Kenneth Yamada (Addgene plasmid # 105312 ; http://n2t.net/addgene:105312 ; RRID:Addgene_105312) -
For your References section:
Dense fibrillar collagen is a potent inducer of invadopodia via a specific signaling network. Artym VV, Swatkoski S, Matsumoto K, Campbell CB, Petrie RJ, Dimitriadis EK, Li X, Mueller SC, Bugge TH, Gucek M, Yamada KM. J Cell Biol. 2015 Feb 2;208(3):331-50. doi: 10.1083/jcb.201405099. 10.1083/jcb.201405099 PubMed 25646088