Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEGFP Kind2 S181E
(Plasmid #105312)


Item Catalog # Description Quantity Price (USD)
Plasmid 105312 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Alt name
    fermitin family member 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
  • GenBank ID
  • Entrez Gene
    FERMT2 (a.k.a. KIND2, MIG2, PLEKHC1, UNC112, UNC112B, mig-2)
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (unknown if destroyed)
  • 3′ cloning site BamH1 (unknown if destroyed)
  • 5′ sequencing primer GGGAAAAGAAGAGAACTTGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Mutation in Kindlin2 was introduced by using site-directed mutagenesis (Stratagene)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP Kind2 S181E was a gift from Kenneth Yamada (Addgene plasmid # 105312 ; ; RRID:Addgene_105312)