pmKikGR Actin
(Plasmid
#105315)
-
PurposePhotoconvertable cytoskeletal protein actin to study kinetics or dynamics
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105315 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepmKikGRNB
-
Backbone manufacturermodified pEGFP-C1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameactin beta
-
Alt nameACTB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1100
-
Entrez GeneACTB (a.k.a. BKRNS, BNS, BRWS1, CSMH, DDS1, PS1TP5BP1, THC8)
-
Tag
/ Fusion Protein
- KikGR (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (unknown if destroyed)
- 3′ cloning site Xba1 (unknown if destroyed)
- 5′ sequencing primer TCCAGTTGCCAGACTATCAC
- 3′ sequencing primer ATGTTTCAGGTTCAGGGGGAGGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pmKikGR was constructed by inserting sequence corresponding to mKikGR with Kozak sequence to replace EGFP in Nhe1 /BglII sites of pEGFP NBC1. mKikGR was from Dr. Atsushi Miyawaki (Riken BSI).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmKikGR Actin was a gift from Kenneth Yamada (Addgene plasmid # 105315 ; http://n2t.net/addgene:105315 ; RRID:Addgene_105315) -
For your References section:
Micro-environmental control of cell migration--myosin IIA is required for efficient migration in fibrillar environments through control of cell adhesion dynamics. Doyle AD, Kutys ML, Conti MA, Matsumoto K, Adelstein RS, Yamada KM. J Cell Sci. 2012 May 1;125(Pt 9):2244-56. doi: 10.1242/jcs.098806. Epub 2012 Feb 10. 10.1242/jcs.098806 PubMed 22328520