pmKikGR Vinculin
(Plasmid #105316)

• Purpose: Photoconvertable focal adhesion protein vinculin to study kinetics or dynamics
• Depositing Lab: Kenneth Yamada
• Publication: Doyle et al J Cell Sci. 2012 May 1;125(Pt 9):2244-56. doi: 10.1242/jcs.098806. Epub 2012 Feb 10.

Backbone

• Vector backbone: pmKikGRNB
• Backbone manufacturer: modified pEGFP-C1
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: vinculin
• Alt name: VCL
• Alt name: NM_205441
• Species: G. gallus (chicken)
• Insert Size (bp): 3200
• Tag / Fusion Protein:
  • KikGR (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (unknown if destroyed)
• 3′ cloning site: Xba1 (unknown if destroyed)
• 5′ sequencing primer: TCCAGTTGCCAGACTATCAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pmKikGR was constructed by inserting sequence corresponding to mKikGR with Kozak sequence to replace EGFP in Nhe1 /BglII sites of pEGFP NBC1. Vinculin cDNA was from Dr. Benjamin Geiger (Weizmann Institute) and mKikGR was from Dr. Atsushi Miyawaki (Riken BSI).