Skip to main content

pGEMHE-mEGFP-mTrim21
(Plasmid #105519)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105519 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEMHE
  • Backbone size w/o insert (bp) 3816
  • Total vector size (bp) 5205
  • Vector type
    in vitro Transcription

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TRIM21
  • Alt name
    Ro52
  • Alt name
    Ssa1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1389
  • GenBank ID
    NM_001082552.2
  • Entrez Gene
    Trim21 (a.k.a. Ro52, Ssa1)
  • Promoter T7
  • Tag / Fusion Protein
    • mEGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer TCGGGTGTTCTTGAGGCTGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Trim sequence was originally cloned by Leo James/William McEwan also MRC Laboratory of Molecular Biology

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The sequence contains an E318K in mTrim21. This mutation does not affect plasmid function as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEMHE-mEGFP-mTrim21 was a gift from Melina Schuh (Addgene plasmid # 105519 ; http://n2t.net/addgene:105519 ; RRID:Addgene_105519)
  • For your References section:

    A Method for the Acute and Rapid Degradation of Endogenous Proteins. Clift D, McEwan WA, Labzin LI, Konieczny V, Mogessie B, James LC, Schuh M. Cell. 2017 Nov 13. pii: S0092-8674(17)31255-2. doi: 10.1016/j.cell.2017.10.033. 10.1016/j.cell.2017.10.033 PubMed 29153837