Skip to main content

TRIN-shMYB.2572
(Plasmid #105574)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105574 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    TRE-dsRED/mir30-shRNA-PGK-venus-IRES-neo
  • Vector type
    Mammalian Expression, Retroviral, RNAi
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MYB shRNA #2572
  • gRNA/shRNA sequence
    TGCTGTTGACAGTGAGCGCTCCATGTATCTCAGTCACTAATAGTGAAGCCACAGATGTATTAGTGACTGAGATACATGGAATGCCTACTGCCTCGGA
  • Species
    M. musculus (mouse)
  • Promoter TRE

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer TGT TTG AAT GAG GCT TCA GTA C
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TRIN-shMYB.2572 was a gift from Christopher Vakoc (Addgene plasmid # 105574 ; http://n2t.net/addgene:105574 ; RRID:Addgene_105574)
  • For your References section:

    A TFIID-SAGA Perturbation that Targets MYB and Suppresses Acute Myeloid Leukemia. Xu Y, Milazzo JP, Somerville TDD, Tarumoto Y, Huang YH, Ostrander EL, Wilkinson JE, Challen GA, Vakoc CR. Cancer Cell. 2018 Jan 8;33(1):13-28.e8. doi: 10.1016/j.ccell.2017.12.002. 10.1016/j.ccell.2017.12.002 PubMed 29316427