LRG-neo-sgTAF12(mouse)#4.1
(Plasmid
#105588)
-
Purposelentivirally express gRNA targeting human TAF12 HFD with GFP marker and neo resistance
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105588 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLRG 2.1T(hU6-sgRNA- EFS-GFP-P2A-Neo)
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA targeting TAF12 HFD
-
gRNA/shRNA sequenceACTTGCGGTGCCGAGCAAGC
-
SpeciesM. musculus (mouse)
- Promoter hU6
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GAC TAT CAT ATG CTT ACC GT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LRG-neo-sgTAF12(mouse)#4.1 was a gift from Christopher Vakoc (Addgene plasmid # 105588 ; http://n2t.net/addgene:105588 ; RRID:Addgene_105588) -
For your References section:
A TFIID-SAGA Perturbation that Targets MYB and Suppresses Acute Myeloid Leukemia. Xu Y, Milazzo JP, Somerville TDD, Tarumoto Y, Huang YH, Ostrander EL, Wilkinson JE, Challen GA, Vakoc CR. Cancer Cell. 2018 Jan 8;33(1):13-28.e8. doi: 10.1016/j.ccell.2017.12.002. 10.1016/j.ccell.2017.12.002 PubMed 29316427