Skip to main content

pUA66 PcspA GFP Linker
(Plasmid #105604)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105604 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUA66
  • Backbone size w/o insert (bp) 3200
  • Total vector size (bp) 4494
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • Species
    Synthetic
  • Promoter PcspA

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCGGCAAGAAAGCCATCCAG
  • 3′ sequencing primer GCATCACCTTCACCCTCTCCACTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUA66 PcspA GFP Linker was a gift from Pamela Silver (Addgene plasmid # 105604 ; http://n2t.net/addgene:105604 ; RRID:Addgene_105604)
  • For your References section:

    Rational Design of Evolutionarily Stable Microbial Kill Switches. Stirling F, Bitzan L, O'Keefe S, Redfield E, Oliver JWK, Way J, Silver PA. Mol Cell. 2017 Nov 16;68(4):686-697.e3. doi: 10.1016/j.molcel.2017.10.033. 10.1016/j.molcel.2017.10.033 PubMed 29149596