pUA66 PrpsL GFP
(Plasmid
#105606)
-
PurposeExpresses GFP under PrpsL
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUA66
- Backbone size w/o insert (bp) 3200
- Total vector size (bp) 4596
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGFP
-
SpeciesSynthetic
- Promoter PrpsL
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCGGCAAGAAAGCCATCCAG
- 3′ sequencing primer GCATCACCTTCACCCTCTCCACTG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUA66 PrpsL GFP was a gift from Pamela Silver (Addgene plasmid # 105606 ; http://n2t.net/addgene:105606 ; RRID:Addgene_105606) -
For your References section:
Rational Design of Evolutionarily Stable Microbial Kill Switches. Stirling F, Bitzan L, O'Keefe S, Redfield E, Oliver JWK, Way J, Silver PA. Mol Cell. 2017 Nov 16;68(4):686-697.e3. doi: 10.1016/j.molcel.2017.10.033. 10.1016/j.molcel.2017.10.033 PubMed 29149596