Skip to main content

pAAV-CKIIa-stGtACR1-FusionRed
(Plasmid #105679)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105679 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5360
  • Total vector size (bp) 7223
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Use recA deficient growth strain to prevent homologous recombination.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    stGtACR1
  • Alt name
    soma-targeted Guillardia theta anion-conducting channelrhodopsin 1
  • Species
    Synthetic; Guillardia theta
  • Insert Size (bp)
    1851
  • Promoter CaMKIIa
  • Tags / Fusion Proteins
    • FusionRed (C terminal on backbone)
    • Kv2.1 (C terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GATGCTGACGAAGGCTCGC
  • 3′ sequencing primer CACATAGCGTAAAAGGAGCAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CKIIa-stGtACR1-FusionRed was a gift from Ofer Yizhar (Addgene plasmid # 105679 ; http://n2t.net/addgene:105679 ; RRID:Addgene_105679)
  • For your References section:

    High-efficiency optogenetic silencing with soma-targeted anion-conducting channelrhodopsins. Mahn M, Gibor L, Patil P, Cohen-Kashi Malina K, Oring S, Printz Y, Levy R, Lampl I, Yizhar O. Nat Commun. 2018 Oct 8;9(1):4125. doi: 10.1038/s41467-018-06511-8. 10.1038/s41467-018-06511-8 PubMed 30297821