-
PurposeExpresses a soma-targeted GtACR1 in mammalian neurons under the CaMKIIa promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 105679 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5360
- Total vector size (bp) 7223
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsUse recA deficient growth strain to prevent homologous recombination.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namestGtACR1
-
Alt namesoma-targeted Guillardia theta anion-conducting channelrhodopsin 1
-
SpeciesSynthetic; Guillardia theta
-
Insert Size (bp)1851
- Promoter CaMKIIa
-
Tags
/ Fusion Proteins
- FusionRed (C terminal on backbone)
- Kv2.1 (C terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GATGCTGACGAAGGCTCGC
- 3′ sequencing primer CACATAGCGTAAAAGGAGCAAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CKIIa-stGtACR1-FusionRed was a gift from Ofer Yizhar (Addgene plasmid # 105679 ; http://n2t.net/addgene:105679 ; RRID:Addgene_105679) -
For your References section:
High-efficiency optogenetic silencing with soma-targeted anion-conducting channelrhodopsins. Mahn M, Gibor L, Patil P, Cohen-Kashi Malina K, Oring S, Printz Y, Levy R, Lampl I, Yizhar O. Nat Commun. 2018 Oct 8;9(1):4125. doi: 10.1038/s41467-018-06511-8. 10.1038/s41467-018-06511-8 PubMed 30297821